ID: 1053785694

View in Genome Browser
Species Human (GRCh38)
Location 9:41651061-41651083
Sequence CAAAAGGGTAAATAGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053785694_1053785703 29 Left 1053785694 9:41651061-41651083 CCTGAGCTCTATTTACCCTTTTG No data
Right 1053785703 9:41651113-41651135 CTCCTAGCTGGTTTCCTAGAGGG No data
1053785694_1053785702 28 Left 1053785694 9:41651061-41651083 CCTGAGCTCTATTTACCCTTTTG No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data
1053785694_1053785701 17 Left 1053785694 9:41651061-41651083 CCTGAGCTCTATTTACCCTTTTG No data
Right 1053785701 9:41651101-41651123 AAGTACACAACTCTCCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053785694 Original CRISPR CAAAAGGGTAAATAGAGCTC AGG (reversed) Intergenic