ID: 1053785695

View in Genome Browser
Species Human (GRCh38)
Location 9:41651076-41651098
Sequence GGAGGGATGGAGTTACAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053785695_1053785701 2 Left 1053785695 9:41651076-41651098 CCCTTTTGTAACTCCATCCCTCC No data
Right 1053785701 9:41651101-41651123 AAGTACACAACTCTCCTAGCTGG No data
1053785695_1053785702 13 Left 1053785695 9:41651076-41651098 CCCTTTTGTAACTCCATCCCTCC No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data
1053785695_1053785703 14 Left 1053785695 9:41651076-41651098 CCCTTTTGTAACTCCATCCCTCC No data
Right 1053785703 9:41651113-41651135 CTCCTAGCTGGTTTCCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053785695 Original CRISPR GGAGGGATGGAGTTACAAAA GGG (reversed) Intergenic
No off target data available for this crispr