ID: 1053785699

View in Genome Browser
Species Human (GRCh38)
Location 9:41651094-41651116
Sequence GGAGAGTTGTGTACTTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053785699_1053785702 -5 Left 1053785699 9:41651094-41651116 CCTCCATAAGTACACAACTCTCC No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data
1053785699_1053785703 -4 Left 1053785699 9:41651094-41651116 CCTCCATAAGTACACAACTCTCC No data
Right 1053785703 9:41651113-41651135 CTCCTAGCTGGTTTCCTAGAGGG No data
1053785699_1053785706 18 Left 1053785699 9:41651094-41651116 CCTCCATAAGTACACAACTCTCC No data
Right 1053785706 9:41651135-41651157 GCAGATACAGTGTTTCCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053785699 Original CRISPR GGAGAGTTGTGTACTTATGG AGG (reversed) Intergenic