ID: 1053785700

View in Genome Browser
Species Human (GRCh38)
Location 9:41651097-41651119
Sequence CTAGGAGAGTTGTGTACTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053785700_1053785706 15 Left 1053785700 9:41651097-41651119 CCATAAGTACACAACTCTCCTAG No data
Right 1053785706 9:41651135-41651157 GCAGATACAGTGTTTCCAGTCGG No data
1053785700_1053785703 -7 Left 1053785700 9:41651097-41651119 CCATAAGTACACAACTCTCCTAG No data
Right 1053785703 9:41651113-41651135 CTCCTAGCTGGTTTCCTAGAGGG No data
1053785700_1053785702 -8 Left 1053785700 9:41651097-41651119 CCATAAGTACACAACTCTCCTAG No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053785700 Original CRISPR CTAGGAGAGTTGTGTACTTA TGG (reversed) Intergenic
No off target data available for this crispr