ID: 1053785702

View in Genome Browser
Species Human (GRCh38)
Location 9:41651112-41651134
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053785693_1053785702 29 Left 1053785693 9:41651060-41651082 CCCTGAGCTCTATTTACCCTTTT 0: 7
1: 0
2: 0
3: 16
4: 239
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data
1053785697_1053785702 0 Left 1053785697 9:41651089-41651111 CCATCCCTCCATAAGTACACAAC No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data
1053785700_1053785702 -8 Left 1053785700 9:41651097-41651119 CCATAAGTACACAACTCTCCTAG No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data
1053785695_1053785702 13 Left 1053785695 9:41651076-41651098 CCCTTTTGTAACTCCATCCCTCC No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data
1053785699_1053785702 -5 Left 1053785699 9:41651094-41651116 CCTCCATAAGTACACAACTCTCC No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data
1053785698_1053785702 -4 Left 1053785698 9:41651093-41651115 CCCTCCATAAGTACACAACTCTC No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data
1053785696_1053785702 12 Left 1053785696 9:41651077-41651099 CCTTTTGTAACTCCATCCCTCCA No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data
1053785694_1053785702 28 Left 1053785694 9:41651061-41651083 CCTGAGCTCTATTTACCCTTTTG No data
Right 1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053785702 Original CRISPR TCTCCTAGCTGGTTTCCTAG AGG Intergenic