ID: 1053785706

View in Genome Browser
Species Human (GRCh38)
Location 9:41651135-41651157
Sequence GCAGATACAGTGTTTCCAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053785698_1053785706 19 Left 1053785698 9:41651093-41651115 CCCTCCATAAGTACACAACTCTC No data
Right 1053785706 9:41651135-41651157 GCAGATACAGTGTTTCCAGTCGG No data
1053785700_1053785706 15 Left 1053785700 9:41651097-41651119 CCATAAGTACACAACTCTCCTAG No data
Right 1053785706 9:41651135-41651157 GCAGATACAGTGTTTCCAGTCGG No data
1053785704_1053785706 -3 Left 1053785704 9:41651115-41651137 CCTAGCTGGTTTCCTAGAGGGCA No data
Right 1053785706 9:41651135-41651157 GCAGATACAGTGTTTCCAGTCGG No data
1053785699_1053785706 18 Left 1053785699 9:41651094-41651116 CCTCCATAAGTACACAACTCTCC No data
Right 1053785706 9:41651135-41651157 GCAGATACAGTGTTTCCAGTCGG No data
1053785697_1053785706 23 Left 1053785697 9:41651089-41651111 CCATCCCTCCATAAGTACACAAC No data
Right 1053785706 9:41651135-41651157 GCAGATACAGTGTTTCCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053785706 Original CRISPR GCAGATACAGTGTTTCCAGT CGG Intergenic