ID: 1053787030

View in Genome Browser
Species Human (GRCh38)
Location 9:41659430-41659452
Sequence TATCCCTCCCTCTCTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053787030_1053787032 6 Left 1053787030 9:41659430-41659452 CCAGCACCAGAGAGGGAGGGATA No data
Right 1053787032 9:41659459-41659481 ACACAGTGTTGCAGATAATCAGG No data
1053787030_1053787033 19 Left 1053787030 9:41659430-41659452 CCAGCACCAGAGAGGGAGGGATA No data
Right 1053787033 9:41659472-41659494 GATAATCAGGACCCATTTACCGG No data
1053787030_1053787034 20 Left 1053787030 9:41659430-41659452 CCAGCACCAGAGAGGGAGGGATA No data
Right 1053787034 9:41659473-41659495 ATAATCAGGACCCATTTACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053787030 Original CRISPR TATCCCTCCCTCTCTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr