ID: 1053787184

View in Genome Browser
Species Human (GRCh38)
Location 9:41660553-41660575
Sequence CTGGCTACACATTAGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053787184_1053787188 -1 Left 1053787184 9:41660553-41660575 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1053787188 9:41660575-41660597 GAGGTTGAGATGCAGGCCCTAGG No data
1053787184_1053787195 25 Left 1053787184 9:41660553-41660575 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1053787195 9:41660601-41660623 TGATACAAGAGATAAGGGGAGGG No data
1053787184_1053787191 19 Left 1053787184 9:41660553-41660575 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1053787191 9:41660595-41660617 AGGAAATGATACAAGAGATAAGG No data
1053787184_1053787192 20 Left 1053787184 9:41660553-41660575 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1053787192 9:41660596-41660618 GGAAATGATACAAGAGATAAGGG No data
1053787184_1053787193 21 Left 1053787184 9:41660553-41660575 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1053787193 9:41660597-41660619 GAAATGATACAAGAGATAAGGGG No data
1053787184_1053787186 -8 Left 1053787184 9:41660553-41660575 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1053787186 9:41660568-41660590 GTAGCCAGAGGTTGAGATGCAGG No data
1053787184_1053787194 24 Left 1053787184 9:41660553-41660575 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1053787194 9:41660600-41660622 ATGATACAAGAGATAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053787184 Original CRISPR CTGGCTACACATTAGCAACC TGG (reversed) Intergenic
No off target data available for this crispr