ID: 1053788676

View in Genome Browser
Species Human (GRCh38)
Location 9:41670450-41670472
Sequence GAACCCAAGTTGGGACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053788666_1053788676 18 Left 1053788666 9:41670409-41670431 CCAGGTGAAAGACTATGAGCCTG No data
Right 1053788676 9:41670450-41670472 GAACCCAAGTTGGGACAGGCAGG No data
1053788665_1053788676 19 Left 1053788665 9:41670408-41670430 CCCAGGTGAAAGACTATGAGCCT No data
Right 1053788676 9:41670450-41670472 GAACCCAAGTTGGGACAGGCAGG No data
1053788664_1053788676 29 Left 1053788664 9:41670398-41670420 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1053788676 9:41670450-41670472 GAACCCAAGTTGGGACAGGCAGG No data
1053788672_1053788676 -1 Left 1053788672 9:41670428-41670450 CCTGTCGGAAGGGATCAGGGTAG No data
Right 1053788676 9:41670450-41670472 GAACCCAAGTTGGGACAGGCAGG No data
1053788663_1053788676 30 Left 1053788663 9:41670397-41670419 CCCAGAGAAAGCCCAGGTGAAAG No data
Right 1053788676 9:41670450-41670472 GAACCCAAGTTGGGACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053788676 Original CRISPR GAACCCAAGTTGGGACAGGC AGG Intergenic
No off target data available for this crispr