ID: 1053788782

View in Genome Browser
Species Human (GRCh38)
Location 9:41671274-41671296
Sequence TCTGCTGAGGGACAGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053788782_1053788793 23 Left 1053788782 9:41671274-41671296 CCTCCAAACTGTCCCTCAGCAGA No data
Right 1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG No data
1053788782_1053788790 8 Left 1053788782 9:41671274-41671296 CCTCCAAACTGTCCCTCAGCAGA No data
Right 1053788790 9:41671305-41671327 GATCTTCCCTAACTTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053788782 Original CRISPR TCTGCTGAGGGACAGTTTGG AGG (reversed) Intergenic
No off target data available for this crispr