ID: 1053788784

View in Genome Browser
Species Human (GRCh38)
Location 9:41671277-41671299
Sequence CCCTCTGCTGAGGGACAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053788784_1053788790 5 Left 1053788784 9:41671277-41671299 CCAAACTGTCCCTCAGCAGAGGG No data
Right 1053788790 9:41671305-41671327 GATCTTCCCTAACTTGACCCAGG No data
1053788784_1053788793 20 Left 1053788784 9:41671277-41671299 CCAAACTGTCCCTCAGCAGAGGG No data
Right 1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053788784 Original CRISPR CCCTCTGCTGAGGGACAGTT TGG (reversed) Intergenic
No off target data available for this crispr