ID: 1053788789

View in Genome Browser
Species Human (GRCh38)
Location 9:41671301-41671323
Sequence GGTCAAGTTAGGGAAGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053788789_1053788793 -4 Left 1053788789 9:41671301-41671323 CCTGGATCTTCCCTAACTTGACC No data
Right 1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG No data
1053788789_1053788799 23 Left 1053788789 9:41671301-41671323 CCTGGATCTTCCCTAACTTGACC No data
Right 1053788799 9:41671347-41671369 TCCCCTTCCCCACCCATTGCAGG No data
1053788789_1053788801 24 Left 1053788789 9:41671301-41671323 CCTGGATCTTCCCTAACTTGACC No data
Right 1053788801 9:41671348-41671370 CCCCTTCCCCACCCATTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053788789 Original CRISPR GGTCAAGTTAGGGAAGATCC AGG (reversed) Intergenic
No off target data available for this crispr