ID: 1053788793

View in Genome Browser
Species Human (GRCh38)
Location 9:41671320-41671342
Sequence GACCCAGGCATTATTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053788789_1053788793 -4 Left 1053788789 9:41671301-41671323 CCTGGATCTTCCCTAACTTGACC No data
Right 1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG No data
1053788788_1053788793 10 Left 1053788788 9:41671287-41671309 CCTCAGCAGAGGGACCTGGATCT No data
Right 1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG No data
1053788782_1053788793 23 Left 1053788782 9:41671274-41671296 CCTCCAAACTGTCCCTCAGCAGA No data
Right 1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG No data
1053788784_1053788793 20 Left 1053788784 9:41671277-41671299 CCAAACTGTCCCTCAGCAGAGGG No data
Right 1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG No data
1053788787_1053788793 11 Left 1053788787 9:41671286-41671308 CCCTCAGCAGAGGGACCTGGATC No data
Right 1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053788793 Original CRISPR GACCCAGGCATTATTTCCCC AGG Intergenic
No off target data available for this crispr