ID: 1053792046

View in Genome Browser
Species Human (GRCh38)
Location 9:41693593-41693615
Sequence CTACCTTCAAGAAGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053792046_1053792053 7 Left 1053792046 9:41693593-41693615 CCTGCTGAGCTTCTTGAAGGTAG No data
Right 1053792053 9:41693623-41693645 AGTCAGGGCCCTGTGGTGACTGG No data
1053792046_1053792054 14 Left 1053792046 9:41693593-41693615 CCTGCTGAGCTTCTTGAAGGTAG No data
Right 1053792054 9:41693630-41693652 GCCCTGTGGTGACTGGTGAGAGG No data
1053792046_1053792051 -8 Left 1053792046 9:41693593-41693615 CCTGCTGAGCTTCTTGAAGGTAG No data
Right 1053792051 9:41693608-41693630 GAAGGTAGGAATGGGAGTCAGGG No data
1053792046_1053792050 -9 Left 1053792046 9:41693593-41693615 CCTGCTGAGCTTCTTGAAGGTAG No data
Right 1053792050 9:41693607-41693629 TGAAGGTAGGAATGGGAGTCAGG No data
1053792046_1053792052 0 Left 1053792046 9:41693593-41693615 CCTGCTGAGCTTCTTGAAGGTAG No data
Right 1053792052 9:41693616-41693638 GAATGGGAGTCAGGGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053792046 Original CRISPR CTACCTTCAAGAAGCTCAGC AGG (reversed) Intergenic
No off target data available for this crispr