ID: 1053800347

View in Genome Browser
Species Human (GRCh38)
Location 9:41760072-41760094
Sequence AAACCCATGCTGCTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053800347_1053800350 -4 Left 1053800347 9:41760072-41760094 CCAGGCAGAAGCAGCATGGGTTT No data
Right 1053800350 9:41760091-41760113 GTTTCCACTCACACGGTAGGCGG No data
1053800347_1053800352 14 Left 1053800347 9:41760072-41760094 CCAGGCAGAAGCAGCATGGGTTT No data
Right 1053800352 9:41760109-41760131 GGCGGCTGTGCAATTTCGTCTGG No data
1053800347_1053800349 -7 Left 1053800347 9:41760072-41760094 CCAGGCAGAAGCAGCATGGGTTT No data
Right 1053800349 9:41760088-41760110 TGGGTTTCCACTCACACGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053800347 Original CRISPR AAACCCATGCTGCTTCTGCC TGG (reversed) Intergenic
No off target data available for this crispr