ID: 1053800896

View in Genome Browser
Species Human (GRCh38)
Location 9:41764074-41764096
Sequence TCAAGTGGCCGCCTTCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053800892_1053800896 9 Left 1053800892 9:41764042-41764064 CCGGGTGTGACAGAGGCTCCTAG No data
Right 1053800896 9:41764074-41764096 TCAAGTGGCCGCCTTCACAGAGG No data
1053800894_1053800896 -9 Left 1053800894 9:41764060-41764082 CCTAGAATCCTGTCTCAAGTGGC No data
Right 1053800896 9:41764074-41764096 TCAAGTGGCCGCCTTCACAGAGG No data
1053800890_1053800896 20 Left 1053800890 9:41764031-41764053 CCTGTGCACTGCCGGGTGTGACA No data
Right 1053800896 9:41764074-41764096 TCAAGTGGCCGCCTTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053800896 Original CRISPR TCAAGTGGCCGCCTTCACAG AGG Intergenic
No off target data available for this crispr