ID: 1053802693

View in Genome Browser
Species Human (GRCh38)
Location 9:41774290-41774312
Sequence CCTCACCAGAAGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053802685_1053802693 -4 Left 1053802685 9:41774271-41774293 CCTACCTAGGTACTTCTGGCCTC No data
Right 1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG No data
1053802686_1053802693 -8 Left 1053802686 9:41774275-41774297 CCTAGGTACTTCTGGCCTCACCA No data
Right 1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053802693 Original CRISPR CCTCACCAGAAGAAGGGGGA GGG Intergenic
No off target data available for this crispr