ID: 1053808900

View in Genome Browser
Species Human (GRCh38)
Location 9:41832556-41832578
Sequence ATGAAGGTGGATCTGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053808900_1053808906 13 Left 1053808900 9:41832556-41832578 CCAGGCTACAGATCCACCTTCAT No data
Right 1053808906 9:41832592-41832614 AGACCTGTTCCCATGAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053808900 Original CRISPR ATGAAGGTGGATCTGTAGCC TGG (reversed) Intergenic
No off target data available for this crispr