ID: 1053809017

View in Genome Browser
Species Human (GRCh38)
Location 9:41833126-41833148
Sequence AGAATATCCCCTATGAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053809010_1053809017 12 Left 1053809010 9:41833091-41833113 CCTCATAAACTCAGGTTCTGGGC No data
Right 1053809017 9:41833126-41833148 AGAATATCCCCTATGAACTCAGG No data
1053809007_1053809017 16 Left 1053809007 9:41833087-41833109 CCAGCCTCATAAACTCAGGTTCT No data
Right 1053809017 9:41833126-41833148 AGAATATCCCCTATGAACTCAGG No data
1053809006_1053809017 17 Left 1053809006 9:41833086-41833108 CCCAGCCTCATAAACTCAGGTTC No data
Right 1053809017 9:41833126-41833148 AGAATATCCCCTATGAACTCAGG No data
1053809012_1053809017 -10 Left 1053809012 9:41833113-41833135 CCCGCCCGGTACCAGAATATCCC No data
Right 1053809017 9:41833126-41833148 AGAATATCCCCTATGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053809017 Original CRISPR AGAATATCCCCTATGAACTC AGG Intergenic
No off target data available for this crispr