ID: 1053821807

View in Genome Browser
Species Human (GRCh38)
Location 9:41975117-41975139
Sequence GGCCTCGGGGAGCACCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053821804_1053821807 -10 Left 1053821804 9:41975104-41975126 CCGGGAAGGCTGGGGCCTCGGGG 0: 2
1: 2
2: 3
3: 64
4: 430
Right 1053821807 9:41975117-41975139 GGCCTCGGGGAGCACCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053821807 Original CRISPR GGCCTCGGGGAGCACCTGCA GGG Intronic
No off target data available for this crispr