ID: 1053823887

View in Genome Browser
Species Human (GRCh38)
Location 9:41999397-41999419
Sequence CTGAAGTTCTCTAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053823884_1053823887 19 Left 1053823884 9:41999355-41999377 CCTCATCCAATCAGTTGAAGGCT 0: 32
1: 235
2: 564
3: 821
4: 1049
Right 1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG No data
1053823885_1053823887 13 Left 1053823885 9:41999361-41999383 CCAATCAGTTGAAGGCTGTAAGA 0: 4
1: 15
2: 101
3: 316
4: 656
Right 1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053823887 Original CRISPR CTGAAGTTCTCTAGGAAAGA AGG Intronic
No off target data available for this crispr