ID: 1053826274

View in Genome Browser
Species Human (GRCh38)
Location 9:42028021-42028043
Sequence CCTTCTGTACTAAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053826271_1053826274 -8 Left 1053826271 9:42028006-42028028 CCTGGCACAAATATGCCTTCTGT 0: 2
1: 0
2: 2
3: 14
4: 206
Right 1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053826274 Original CRISPR CCTTCTGTACTAAAGGAAGA TGG Intronic
No off target data available for this crispr