ID: 1053856370

View in Genome Browser
Species Human (GRCh38)
Location 9:42342764-42342786
Sequence CTGCTGATGTTCAGGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053856370_1053856381 15 Left 1053856370 9:42342764-42342786 CCCTTTATCCTGAACATCAGCAG No data
Right 1053856381 9:42342802-42342824 CCAGGCAAATTCTGAGATCCAGG No data
1053856370_1053856382 26 Left 1053856370 9:42342764-42342786 CCCTTTATCCTGAACATCAGCAG No data
Right 1053856382 9:42342813-42342835 CTGAGATCCAGGACCTATTGAGG No data
1053856370_1053856377 -3 Left 1053856370 9:42342764-42342786 CCCTTTATCCTGAACATCAGCAG No data
Right 1053856377 9:42342784-42342806 CAGGTGGGCCCAGGACTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053856370 Original CRISPR CTGCTGATGTTCAGGATAAA GGG (reversed) Intergenic
No off target data available for this crispr