ID: 1053857060

View in Genome Browser
Species Human (GRCh38)
Location 9:42348506-42348528
Sequence CTGTTGGTATGGAGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053857054_1053857060 4 Left 1053857054 9:42348479-42348501 CCAAACAACCAAATCAGCTGTAA No data
Right 1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG No data
1053857055_1053857060 -4 Left 1053857055 9:42348487-42348509 CCAAATCAGCTGTAAATGCCTGT No data
Right 1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053857060 Original CRISPR CTGTTGGTATGGAGGACAGA AGG Intergenic
No off target data available for this crispr