ID: 1053861050

View in Genome Browser
Species Human (GRCh38)
Location 9:42386598-42386620
Sequence AGGGGAAATAAGAGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053861050_1053861057 1 Left 1053861050 9:42386598-42386620 CCAGCATCCCTCTTATTTCCCCT No data
Right 1053861057 9:42386622-42386644 GGAGTTGTTTTTATTTGCTTTGG No data
1053861050_1053861058 2 Left 1053861050 9:42386598-42386620 CCAGCATCCCTCTTATTTCCCCT No data
Right 1053861058 9:42386623-42386645 GAGTTGTTTTTATTTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053861050 Original CRISPR AGGGGAAATAAGAGGGATGC TGG (reversed) Intergenic
No off target data available for this crispr