ID: 1053861050 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:42386598-42386620 |
| Sequence | AGGGGAAATAAGAGGGATGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053861050_1053861057 | 1 | Left | 1053861050 | 9:42386598-42386620 | CCAGCATCCCTCTTATTTCCCCT | No data | ||
| Right | 1053861057 | 9:42386622-42386644 | GGAGTTGTTTTTATTTGCTTTGG | No data | ||||
| 1053861050_1053861058 | 2 | Left | 1053861050 | 9:42386598-42386620 | CCAGCATCCCTCTTATTTCCCCT | No data | ||
| Right | 1053861058 | 9:42386623-42386645 | GAGTTGTTTTTATTTGCTTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053861050 | Original CRISPR | AGGGGAAATAAGAGGGATGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||