ID: 1053865161

View in Genome Browser
Species Human (GRCh38)
Location 9:42429766-42429788
Sequence TTGGACTCACAACTAGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053865155_1053865161 1 Left 1053865155 9:42429742-42429764 CCTAATACGATTCCATGCCTACC No data
Right 1053865161 9:42429766-42429788 TTGGACTCACAACTAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053865161 Original CRISPR TTGGACTCACAACTAGAGTA AGG Intergenic
No off target data available for this crispr