ID: 1053868648

View in Genome Browser
Species Human (GRCh38)
Location 9:42467732-42467754
Sequence GGGTGCCTTCTCATGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053868648_1053868653 7 Left 1053868648 9:42467732-42467754 CCAGATCTCATGAGAAGGCACCC No data
Right 1053868653 9:42467762-42467784 TGAGAACAGCACCAAGGGAATGG No data
1053868648_1053868651 1 Left 1053868648 9:42467732-42467754 CCAGATCTCATGAGAAGGCACCC No data
Right 1053868651 9:42467756-42467778 CTCTCATGAGAACAGCACCAAGG 0: 6
1: 83
2: 401
3: 1220
4: 3885
1053868648_1053868652 2 Left 1053868648 9:42467732-42467754 CCAGATCTCATGAGAAGGCACCC No data
Right 1053868652 9:42467757-42467779 TCTCATGAGAACAGCACCAAGGG 0: 12
1: 136
2: 309
3: 711
4: 1005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053868648 Original CRISPR GGGTGCCTTCTCATGAGATC TGG (reversed) Intergenic
No off target data available for this crispr