ID: 1053868851

View in Genome Browser
Species Human (GRCh38)
Location 9:42469421-42469443
Sequence AGTTATTCGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053868851_1053868854 4 Left 1053868851 9:42469421-42469443 CCTGCCATCTTCTGCGAATAACT No data
Right 1053868854 9:42469448-42469470 TCCTTTTGAGAAACAACTCTTGG 0: 6
1: 30
2: 252
3: 273
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053868851 Original CRISPR AGTTATTCGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr