ID: 1053868851 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:42469421-42469443 |
| Sequence | AGTTATTCGCAGAAGATGGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053868851_1053868854 | 4 | Left | 1053868851 | 9:42469421-42469443 | CCTGCCATCTTCTGCGAATAACT | No data | ||
| Right | 1053868854 | 9:42469448-42469470 | TCCTTTTGAGAAACAACTCTTGG | 0: 6 1: 30 2: 252 3: 273 4: 455 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053868851 | Original CRISPR | AGTTATTCGCAGAAGATGGC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||