ID: 1053871628

View in Genome Browser
Species Human (GRCh38)
Location 9:42498966-42498988
Sequence TAAGATATACACAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053871618_1053871628 23 Left 1053871618 9:42498920-42498942 CCATCGCATTTCATTTGTTATTT No data
Right 1053871628 9:42498966-42498988 TAAGATATACACAAGGGGGAGGG No data
1053871619_1053871628 -9 Left 1053871619 9:42498952-42498974 CCATCCACTGCCCATAAGATATA No data
Right 1053871628 9:42498966-42498988 TAAGATATACACAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053871628 Original CRISPR TAAGATATACACAAGGGGGA GGG Intergenic
No off target data available for this crispr