ID: 1053873045

View in Genome Browser
Species Human (GRCh38)
Location 9:42513776-42513798
Sequence CAGGATCAGCATAAAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053873041_1053873045 -2 Left 1053873041 9:42513755-42513777 CCTTGCAAGACAGGACAAGGACA No data
Right 1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG No data
1053873037_1053873045 19 Left 1053873037 9:42513734-42513756 CCCTGAGACTTAACTGTTGAGCC No data
Right 1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG No data
1053873038_1053873045 18 Left 1053873038 9:42513735-42513757 CCTGAGACTTAACTGTTGAGCCT No data
Right 1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053873045 Original CRISPR CAGGATCAGCATAAAGAGGT GGG Intergenic
No off target data available for this crispr