ID: 1053873093

View in Genome Browser
Species Human (GRCh38)
Location 9:42514189-42514211
Sequence CACACTGTATAAACAGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053873093_1053873094 -4 Left 1053873093 9:42514189-42514211 CCAATATCTGTTTATACAGTGTG No data
Right 1053873094 9:42514208-42514230 TGTGTGTGTTATCATTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053873093 Original CRISPR CACACTGTATAAACAGATAT TGG (reversed) Intergenic
No off target data available for this crispr