ID: 1053874514

View in Genome Browser
Species Human (GRCh38)
Location 9:42529663-42529685
Sequence GACATTTTGCACCATGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053874514_1053874518 6 Left 1053874514 9:42529663-42529685 CCAAGCACATGGTGCAAAATGTC No data
Right 1053874518 9:42529692-42529714 TCTACCATTCTGGGATCTGGAGG 0: 152
1: 1628
2: 2059
3: 1481
4: 979
1053874514_1053874515 -4 Left 1053874514 9:42529663-42529685 CCAAGCACATGGTGCAAAATGTC No data
Right 1053874515 9:42529682-42529704 TGTCAGCAGATCTACCATTCTGG 0: 12
1: 86
2: 976
3: 1350
4: 1848
1053874514_1053874520 13 Left 1053874514 9:42529663-42529685 CCAAGCACATGGTGCAAAATGTC No data
Right 1053874520 9:42529699-42529721 TTCTGGGATCTGGAGGACAGTGG 0: 59
1: 560
2: 1002
3: 1735
4: 2088
1053874514_1053874516 -3 Left 1053874514 9:42529663-42529685 CCAAGCACATGGTGCAAAATGTC No data
Right 1053874516 9:42529683-42529705 GTCAGCAGATCTACCATTCTGGG No data
1053874514_1053874517 3 Left 1053874514 9:42529663-42529685 CCAAGCACATGGTGCAAAATGTC No data
Right 1053874517 9:42529689-42529711 AGATCTACCATTCTGGGATCTGG 0: 18
1: 283
2: 1766
3: 2070
4: 1578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053874514 Original CRISPR GACATTTTGCACCATGTGCT TGG (reversed) Intergenic
No off target data available for this crispr