ID: 1053875176

View in Genome Browser
Species Human (GRCh38)
Location 9:42537430-42537452
Sequence CTGCAGCAACAGAAGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053875173_1053875176 0 Left 1053875173 9:42537407-42537429 CCTGATAACAAACTACTTCCAAA No data
Right 1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053875176 Original CRISPR CTGCAGCAACAGAAGGAAAA TGG Intergenic
No off target data available for this crispr