ID: 1053877365

View in Genome Browser
Species Human (GRCh38)
Location 9:42558136-42558158
Sequence GTGCTGACATGCCAGCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053877365_1053877367 5 Left 1053877365 9:42558136-42558158 CCAAGGGGCTGGCATGTCAGCAC No data
Right 1053877367 9:42558164-42558186 CAAGCATGCACACATGCAGCTGG No data
1053877365_1053877368 6 Left 1053877365 9:42558136-42558158 CCAAGGGGCTGGCATGTCAGCAC No data
Right 1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053877365 Original CRISPR GTGCTGACATGCCAGCCCCT TGG (reversed) Intergenic
No off target data available for this crispr