ID: 1053877368

View in Genome Browser
Species Human (GRCh38)
Location 9:42558165-42558187
Sequence AAGCATGCACACATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053877359_1053877368 23 Left 1053877359 9:42558119-42558141 CCACAGTCCAAAGGGGGCCAAGG No data
Right 1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG No data
1053877364_1053877368 16 Left 1053877364 9:42558126-42558148 CCAAAGGGGGCCAAGGGGCTGGC No data
Right 1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG No data
1053877358_1053877368 26 Left 1053877358 9:42558116-42558138 CCTCCACAGTCCAAAGGGGGCCA No data
Right 1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG No data
1053877365_1053877368 6 Left 1053877365 9:42558136-42558158 CCAAGGGGCTGGCATGTCAGCAC No data
Right 1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053877368 Original CRISPR AAGCATGCACACATGCAGCT GGG Intergenic
No off target data available for this crispr