ID: 1053881033

View in Genome Browser
Species Human (GRCh38)
Location 9:42595188-42595210
Sequence TCATTAACAGGACAGTGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053881028_1053881033 28 Left 1053881028 9:42595137-42595159 CCTTTACTAATGCATTTATTTTG No data
Right 1053881033 9:42595188-42595210 TCATTAACAGGACAGTGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053881033 Original CRISPR TCATTAACAGGACAGTGTTA AGG Intergenic
No off target data available for this crispr