ID: 1053885931

View in Genome Browser
Species Human (GRCh38)
Location 9:42645245-42645267
Sequence ATGGCGGCCGGAGCGCTAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053885919_1053885931 30 Left 1053885919 9:42645192-42645214 CCTGAGCGGTAGGAGGGTAGTCT No data
Right 1053885931 9:42645245-42645267 ATGGCGGCCGGAGCGCTAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053885931 Original CRISPR ATGGCGGCCGGAGCGCTAGG CGG Intergenic