ID: 1053886220

View in Genome Browser
Species Human (GRCh38)
Location 9:42646491-42646513
Sequence GAGGCTCAGGGTCCTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053886212_1053886220 3 Left 1053886212 9:42646465-42646487 CCAGGCATGGAGTAGTGGGCACC No data
Right 1053886220 9:42646491-42646513 GAGGCTCAGGGTCCTGTGGGTGG No data
1053886211_1053886220 4 Left 1053886211 9:42646464-42646486 CCCAGGCATGGAGTAGTGGGCAC No data
Right 1053886220 9:42646491-42646513 GAGGCTCAGGGTCCTGTGGGTGG No data
1053886210_1053886220 5 Left 1053886210 9:42646463-42646485 CCCCAGGCATGGAGTAGTGGGCA No data
Right 1053886220 9:42646491-42646513 GAGGCTCAGGGTCCTGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053886220 Original CRISPR GAGGCTCAGGGTCCTGTGGG TGG Intergenic
No off target data available for this crispr