ID: 1053886357

View in Genome Browser
Species Human (GRCh38)
Location 9:42647106-42647128
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053886342_1053886357 19 Left 1053886342 9:42647064-42647086 CCAGGAAGGGGGAGTAGGAGAGC No data
Right 1053886357 9:42647106-42647128 TGGGGTGGGTAAGAAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053886357 Original CRISPR TGGGGTGGGTAAGAAGCTGC TGG Intergenic
No off target data available for this crispr