ID: 1053894534

View in Genome Browser
Species Human (GRCh38)
Location 9:42730365-42730387
Sequence CATTCCAAACATGAATTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053894534_1053894537 -3 Left 1053894534 9:42730365-42730387 CCACAAAATTCATGTTTGGAATG No data
Right 1053894537 9:42730385-42730407 ATGCTTATATTCCTGCTGGTGGG No data
1053894534_1053894536 -4 Left 1053894534 9:42730365-42730387 CCACAAAATTCATGTTTGGAATG No data
Right 1053894536 9:42730384-42730406 AATGCTTATATTCCTGCTGGTGG No data
1053894534_1053894539 23 Left 1053894534 9:42730365-42730387 CCACAAAATTCATGTTTGGAATG No data
Right 1053894539 9:42730411-42730433 ATAAAACCGTACATCTAGTATGG No data
1053894534_1053894535 -7 Left 1053894534 9:42730365-42730387 CCACAAAATTCATGTTTGGAATG No data
Right 1053894535 9:42730381-42730403 TGGAATGCTTATATTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053894534 Original CRISPR CATTCCAAACATGAATTTTG TGG (reversed) Intergenic
No off target data available for this crispr