ID: 1053896948

View in Genome Browser
Species Human (GRCh38)
Location 9:42752008-42752030
Sequence AATACAATCCCGGCTGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053896948_1053896953 22 Left 1053896948 9:42752008-42752030 CCGCACCCAGCCGGGATTGTATT No data
Right 1053896953 9:42752053-42752075 TCACTATCAGTTTACAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053896948 Original CRISPR AATACAATCCCGGCTGGGTG CGG (reversed) Intergenic
No off target data available for this crispr