ID: 1053899707

View in Genome Browser
Species Human (GRCh38)
Location 9:42782144-42782166
Sequence CAGGATCAGCATAAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053899707_1053899715 19 Left 1053899707 9:42782144-42782166 CCCACCTCTTTATGCTGATCCTG No data
Right 1053899715 9:42782186-42782208 GGCTCAACAGTTAAATCTCAGGG No data
1053899707_1053899714 18 Left 1053899707 9:42782144-42782166 CCCACCTCTTTATGCTGATCCTG No data
Right 1053899714 9:42782185-42782207 AGGCTCAACAGTTAAATCTCAGG No data
1053899707_1053899711 -2 Left 1053899707 9:42782144-42782166 CCCACCTCTTTATGCTGATCCTG No data
Right 1053899711 9:42782165-42782187 TGTCCTTGTCCTGTCTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053899707 Original CRISPR CAGGATCAGCATAAAGAGGT GGG (reversed) Intergenic
No off target data available for this crispr