ID: 1053901883

View in Genome Browser
Species Human (GRCh38)
Location 9:42803791-42803813
Sequence GATCCATGTTGGAATGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053901881_1053901883 9 Left 1053901881 9:42803759-42803781 CCTTTTGTGGTTTGTATAGAGAA No data
Right 1053901883 9:42803791-42803813 GATCCATGTTGGAATGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053901883 Original CRISPR GATCCATGTTGGAATGCTTC AGG Intergenic
No off target data available for this crispr