ID: 1053904079

View in Genome Browser
Species Human (GRCh38)
Location 9:42823808-42823830
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053904077_1053904079 -3 Left 1053904077 9:42823788-42823810 CCTAGAGCATGGGATCCTGGGTT No data
Right 1053904079 9:42823808-42823830 GTTGAACAGCAGAAGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053904079 Original CRISPR GTTGAACAGCAGAAGAAGCC AGG Intergenic
No off target data available for this crispr