ID: 1053906733

View in Genome Browser
Species Human (GRCh38)
Location 9:42851203-42851225
Sequence CAACCACTATGGCCCCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053906729_1053906733 -4 Left 1053906729 9:42851184-42851206 CCCAGTTCCACAGAGAACTCAAC No data
Right 1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG No data
1053906726_1053906733 2 Left 1053906726 9:42851178-42851200 CCCCATCCCAGTTCCACAGAGAA No data
Right 1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG No data
1053906727_1053906733 1 Left 1053906727 9:42851179-42851201 CCCATCCCAGTTCCACAGAGAAC No data
Right 1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG No data
1053906725_1053906733 9 Left 1053906725 9:42851171-42851193 CCGTTCACCCCATCCCAGTTCCA No data
Right 1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG No data
1053906730_1053906733 -5 Left 1053906730 9:42851185-42851207 CCAGTTCCACAGAGAACTCAACC No data
Right 1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG No data
1053906728_1053906733 0 Left 1053906728 9:42851180-42851202 CCATCCCAGTTCCACAGAGAACT No data
Right 1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG No data
1053906724_1053906733 27 Left 1053906724 9:42851153-42851175 CCAAAGGACGGGAACTGGCCGTT No data
Right 1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053906733 Original CRISPR CAACCACTATGGCCCCTGAG CGG Intergenic
No off target data available for this crispr