ID: 1053907634

View in Genome Browser
Species Human (GRCh38)
Location 9:42859823-42859845
Sequence GCTTGATTCACTTCTATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 6, 1: 4, 2: 1, 3: 9, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053907634_1053907640 17 Left 1053907634 9:42859823-42859845 CCATTGATAGAAGTGAATCAAGC 0: 6
1: 4
2: 1
3: 9
4: 112
Right 1053907640 9:42859863-42859885 AGGAAACTGCCACCTGTATTGGG No data
1053907634_1053907635 -3 Left 1053907634 9:42859823-42859845 CCATTGATAGAAGTGAATCAAGC 0: 6
1: 4
2: 1
3: 9
4: 112
Right 1053907635 9:42859843-42859865 AGCAAGTTTGTACCACCCAGAGG 0: 7
1: 3
2: 5
3: 17
4: 112
1053907634_1053907639 16 Left 1053907634 9:42859823-42859845 CCATTGATAGAAGTGAATCAAGC 0: 6
1: 4
2: 1
3: 9
4: 112
Right 1053907639 9:42859862-42859884 GAGGAAACTGCCACCTGTATTGG No data
1053907634_1053907642 26 Left 1053907634 9:42859823-42859845 CCATTGATAGAAGTGAATCAAGC 0: 6
1: 4
2: 1
3: 9
4: 112
Right 1053907642 9:42859872-42859894 CCACCTGTATTGGGAAGCTCTGG 0: 6
1: 7
2: 3
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053907634 Original CRISPR GCTTGATTCACTTCTATCAA TGG (reversed) Intergenic
901103089 1:6734435-6734457 TCTTGATTCACTTATCTCATGGG - Intergenic
909168950 1:72269314-72269336 CCTTGATTCACTCCTTTGAAAGG - Intronic
910750339 1:90622280-90622302 GCTTAATTAACTTTTCTCAAAGG + Intergenic
911246273 1:95521532-95521554 GTTTGATTCACTTTTTTCTAGGG - Intergenic
911319243 1:96392696-96392718 GGTCTCTTCACTTCTATCAAGGG - Intergenic
911946833 1:104121652-104121674 GCTTGATTCATTTCTAATGATGG + Intergenic
914242840 1:145863681-145863703 GTCTGAGTCATTTCTATCAAGGG - Intergenic
914448656 1:147771895-147771917 CCTTGATTCACTGCTCTCTAGGG - Intronic
919146007 1:193635857-193635879 GCTTAAGTGACTTCTATCATAGG + Intergenic
920826433 1:209427767-209427789 GCATGATTCAGTTCCATGAAGGG + Intergenic
1063063666 10:2586751-2586773 GCTTGATTCTCTTCTTTTATAGG - Intergenic
1063874253 10:10455817-10455839 GCTTAGCTTACTTCTATCAAGGG + Intergenic
1069232260 10:66025590-66025612 GCTTTGTTCACCTGTATCAAAGG + Intronic
1071008637 10:80912288-80912310 GCTTGATTCACTCATATCCCTGG - Intergenic
1074463788 10:113664399-113664421 GATTGATTCACTCCTTTAAATGG + Intergenic
1076024172 10:127098966-127098988 GCTTGATTCATTTCTAATATTGG - Intronic
1077875989 11:6306490-6306512 GCTTGCAACATTTCTATCAAGGG - Intergenic
1078465896 11:11550068-11550090 GCTTGATTCTCTGCTCTCTAGGG - Intronic
1080472852 11:32562868-32562890 GATTGATACACTTTTATGAAAGG + Intergenic
1082267961 11:50139960-50139982 GCATGATTGAGTTCTAGCAAGGG + Intergenic
1088047265 11:105469111-105469133 GCTTTAATTACTTCTATAAAGGG + Intergenic
1094683788 12:32690172-32690194 TCTAGATTCACTACTATAAATGG - Intronic
1094806987 12:34103579-34103601 GCTTGCTTCACTTCTCTCCTGGG + Intergenic
1095125829 12:38475034-38475056 GCTTGCTTCACTTCTCTCCTGGG + Intergenic
1099151686 12:79122197-79122219 TCTTTATTGACTTCTTTCAAAGG - Intronic
1101828380 12:108238602-108238624 GCTTCATTGACTTCTCACAATGG + Intronic
1105270702 13:18872679-18872701 GCCTGATTCACTTCTATCAATGG + Intergenic
1108385072 13:49892299-49892321 GCTTGATTCTCCTCTTTCACTGG - Intergenic
1108409936 13:50135096-50135118 GAAGGATTCACTTTTATCAAGGG + Intronic
1113219952 13:108088488-108088510 GCCTAAGTCACTTCTATAAATGG + Intergenic
1116008815 14:39326903-39326925 GCTTGATTCTCCTCTTTCATTGG - Exonic
1122752568 14:103949188-103949210 GCATGATTCATTTCTAGCAGAGG + Intronic
1123205700 14:106711070-106711092 GCTACATTCACATCTATCAAGGG - Intergenic
1123210774 14:106758487-106758509 GCTACATTCACATCTATCAAGGG - Intergenic
1124809760 15:32923780-32923802 GCTGGAATGACTTCTATCCATGG + Intronic
1127321284 15:57848816-57848838 GCTTGATTGACACCTATTAAGGG + Intergenic
1134589925 16:15444190-15444212 GCCTGGTTCACTTATATGAATGG + Intronic
1138333495 16:56234051-56234073 GGTTGATTCACTTCTTTCCTTGG + Intronic
1139093289 16:63675177-63675199 ACTTGATTCATTACAATCAAAGG + Intergenic
1147509828 17:41058446-41058468 CCTTGCCTCACTTCTCTCAATGG + Intergenic
1154417341 18:14187274-14187296 GCTTGATTCACTTCTATCAATGG - Intergenic
1156228193 18:35129520-35129542 TTTTGATTCATTTCTATCATGGG - Intronic
1159388860 18:67761868-67761890 GCTCTCTTCAATTCTATCAAGGG + Intergenic
1160110008 18:76017407-76017429 GACTGATGCACTTCTATAAAGGG - Intergenic
1162652466 19:12100658-12100680 ATTTGATTCCCTTCAATCAAAGG + Intronic
1164157323 19:22604558-22604580 GCTTGTTTCTCCCCTATCAAGGG - Intergenic
1166770277 19:45277786-45277808 GCTTCTGTCACTTCTATCAAAGG + Intronic
927804700 2:26136634-26136656 GCATGATTCATTTCTAGCAGAGG + Exonic
930392868 2:50784248-50784270 GCTTGTTACACTTTTATCAAAGG + Intronic
934499894 2:94849998-94850020 GCTTGATTCACTTCTATCAATGG + Intergenic
934635381 2:95983072-95983094 GCCTCATTCTCTTCTATCGATGG + Intronic
934798252 2:97122151-97122173 GCCTCATTCTCTTCTATCGATGG - Intronic
934835174 2:97581280-97581302 GCCTCATTCTCTTCTATCGATGG + Intronic
936685767 2:114824447-114824469 CCTTGATTCAGTTCTATAAAAGG + Intronic
936951185 2:117979148-117979170 GCCTGATGCACATTTATCAATGG + Intronic
937899792 2:127011168-127011190 GCTTGCTTCTCCTCTATCCAGGG - Intergenic
940310712 2:152275976-152275998 ATTTGATTCCCTTCAATCAAAGG + Intergenic
940574589 2:155484993-155485015 GCTTGATTCCATACTATTAAAGG + Intergenic
942254367 2:174080117-174080139 GTTTGATTGACTTCTAACCAAGG - Intronic
942710411 2:178828546-178828568 GCTGCATTCACTTGAATCAAAGG + Intronic
944961892 2:204884258-204884280 GCCTGATTCATTTATTTCAATGG - Intronic
1169598906 20:7234252-7234274 GTTTCAGTCACTTATATCAATGG + Intergenic
1171778485 20:29394495-29394517 GCTTGCTTCACTTACAACAATGG - Intergenic
1171822542 20:29866945-29866967 GCTTGCTTCACTTACAACAATGG - Intergenic
1171897582 20:30823368-30823390 GCTTGCTTCACTTACAACAATGG + Intergenic
1173698776 20:45047703-45047725 GCTTTATCCAATTCGATCAAGGG - Intronic
1176855979 21:13971985-13972007 GCTTGACTCACTTCTATCAATGG + Intergenic
1178678791 21:34654096-34654118 GCTGGATTCACCTTTGTCAATGG - Intergenic
1180324255 22:11354489-11354511 GCTTGCTTCACTTACAACAATGG - Intergenic
1183723595 22:39576377-39576399 GGTTGAGTCACTTTTATCCAGGG + Intronic
956065472 3:65392959-65392981 GCTTAATTCACTTCAATTCAAGG + Intronic
956451223 3:69377333-69377355 GCTTGCTACACTTTTTTCAAGGG - Intronic
957086671 3:75686060-75686082 GCTTGCTTCACTTACAACAATGG + Intergenic
960291862 3:115895561-115895583 TCTTGATGCACTTCCAGCAAAGG - Intronic
962402606 3:135074296-135074318 ACTTGATGCATTTCAATCAATGG + Intronic
965353338 3:167643203-167643225 GGTGGATCCACTTCAATCAAGGG + Intronic
966407603 3:179614258-179614280 GCTTGATTAAATTCTGTCAGGGG + Intronic
967605038 3:191434609-191434631 GTTTGATTCTCTTCTCTCATTGG + Intergenic
967901498 3:194458198-194458220 TCATAATTCACTTCAATCAATGG + Intronic
968352689 3:198073526-198073548 GCTTGATTTACTTCTGTAAATGG + Intergenic
969018274 4:4120072-4120094 GACTGATTCCCTTCTATCATAGG + Intergenic
969756956 4:9156275-9156297 TCTTGATTCACCTCTAGCACAGG - Intergenic
971568435 4:28176988-28177010 GATTCATTCAGTTCTACCAAAGG - Intergenic
975407717 4:74010859-74010881 ACTTTATTCACATCTATCAGAGG - Intergenic
978272953 4:106913488-106913510 GCTAGATTCTCTTCTCTAAACGG + Intergenic
981816783 4:148840088-148840110 TCTTGATTGATTTCTTTCAAGGG - Intergenic
982590542 4:157303735-157303757 GCTTGATTGAATACTATCAATGG + Exonic
987872642 5:23640785-23640807 GCTTGAATCACTTTAAACAAAGG - Intergenic
989260510 5:39414562-39414584 GCTAGTTTAACTTCTACCAATGG - Intronic
991368161 5:65890620-65890642 GCTTGAATCACTTATTTCAGAGG - Intergenic
995217570 5:109613184-109613206 GCTTGATTATCTCCTATTAAAGG - Intergenic
1000910825 5:167019853-167019875 GCTTGCTTTCCTTCTAGCAAAGG + Intergenic
1003607474 6:7576771-7576793 GCTTGCTTCTCTTCTCTGAATGG + Intronic
1014502884 6:122214477-122214499 ACTTGATTTACTTCTGTAAAAGG - Intergenic
1014596756 6:123353197-123353219 TCTTGAATCAATTCTTTCAATGG - Intronic
1016500849 6:144719151-144719173 CCTTGATCCCCTTCTAACAATGG + Intronic
1016852107 6:148630884-148630906 GCTTCTTTCACTTCTTTCACTGG + Intergenic
1017466609 6:154699961-154699983 GCTTGAATCTCTTCAAGCAAAGG - Intergenic
1024930918 7:54665759-54665781 GATTGGTTCCCTTCTTTCAAAGG + Intergenic
1027507930 7:79041330-79041352 CTTTGACTCATTTCTATCAAAGG - Intronic
1027869552 7:83689445-83689467 GGTTGTTTTACTTTTATCAAAGG + Intergenic
1029697342 7:102222493-102222515 GCTTCATTCAATTCTCCCAATGG - Intronic
1030375626 7:108750083-108750105 GCTTGCTTCACTTCTAGGTAGGG + Intergenic
1031638962 7:124139037-124139059 GATTCATTAACTTCTATTAAAGG + Intergenic
1032742086 7:134749275-134749297 CCTTGAGTCACTTCTATCTTTGG - Intronic
1033108459 7:138553532-138553554 GCTTGATTCAGGCCTTTCAAGGG + Intronic
1033620742 7:143060195-143060217 TCTTGAGTGACTTCAATCAATGG - Intergenic
1039899115 8:41737940-41737962 GTTTGATTCATTTCTAGCACAGG - Intronic
1041384528 8:57285846-57285868 ACTTGATTATTTTCTATCAATGG - Intergenic
1045733537 8:105268240-105268262 GCTTTATTCCCTTCTGTGAAGGG + Intronic
1048457979 8:134595230-134595252 GCATTATTCACCTCTACCAAGGG - Intronic
1051878625 9:21817242-21817264 TCTTGACTAACTTCTAACAATGG - Intronic
1052873532 9:33532718-33532740 GCTTGATTTACTTCTATCAATGG - Intronic
1053502563 9:38612019-38612041 GCTTGATTTATGTCTATCAATGG + Intergenic
1053657272 9:40230532-40230554 GCTTGATTCACTTTTATGAATGG - Intronic
1053907634 9:42859823-42859845 GCTTGATTCACTTCTATCAATGG - Intergenic
1054255647 9:62809519-62809541 GCTTGCTTCACTTACAACAATGG + Intergenic
1054335664 9:63806088-63806110 GCTTGCTTCACTTACAACAATGG - Intergenic
1054369393 9:64376809-64376831 GCTTGATTCACTTCTATCAATGG - Intronic
1054527322 9:66145694-66145716 GCTTGATTCACTTTTATCAATGG + Intronic
1054677024 9:67866565-67866587 GCTTGATTCACTTCTATCAATGG - Intronic
1055917255 9:81417350-81417372 TCCTGATTAACTTGTATCAAGGG - Intergenic
1057153532 9:92817598-92817620 GCTTGATTCACTTCTATCAATGG - Intergenic
1057891549 9:98873851-98873873 GCTAGATTCTCTTGGATCAAGGG + Intergenic
1062414439 9:136440853-136440875 GCTGGATGCACTTCTCTAAAAGG - Exonic
1203371913 Un_KI270442v1:315061-315083 GCTTGCTTCACTTACAACAATGG - Intergenic
1187590818 X:20715161-20715183 GCTTGTTTTCCTTCTCTCAATGG + Intergenic
1189713352 X:43838703-43838725 GATTCATTCACTGTTATCAAAGG - Intronic
1193388914 X:80904360-80904382 CTTTCATTCAATTCTATCAATGG - Intergenic
1193752758 X:85366611-85366633 GATTGATTCACTTAAATCACAGG - Intronic
1198058239 X:133016814-133016836 GCTTGATTCATTTCTGTCAGTGG - Intergenic
1198320108 X:135511942-135511964 GCCTGTTTCCCTTCTACCAATGG - Intergenic