ID: 1053907639

View in Genome Browser
Species Human (GRCh38)
Location 9:42859862-42859884
Sequence GAGGAAACTGCCACCTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053907633_1053907639 23 Left 1053907633 9:42859816-42859838 CCTGACACCATTGATAGAAGTGA 0: 8
1: 4
2: 4
3: 35
4: 414
Right 1053907639 9:42859862-42859884 GAGGAAACTGCCACCTGTATTGG No data
1053907634_1053907639 16 Left 1053907634 9:42859823-42859845 CCATTGATAGAAGTGAATCAAGC 0: 6
1: 4
2: 1
3: 9
4: 112
Right 1053907639 9:42859862-42859884 GAGGAAACTGCCACCTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053907639 Original CRISPR GAGGAAACTGCCACCTGTAT TGG Intergenic
No off target data available for this crispr