ID: 1053909999

View in Genome Browser
Species Human (GRCh38)
Location 9:42888789-42888811
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 14, 1: 1, 2: 1, 3: 11, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053909999 Original CRISPR CTGTAGCAGCAGAAATACTG TGG (reversed) Intergenic
900414381 1:2528359-2528381 CTGTAGCAACAGATCTACTGCGG + Intergenic
900790128 1:4674541-4674563 GTGCAGAAGCAGAAATACGGAGG + Intronic
904259274 1:29279176-29279198 CTGTAGCAGCAGAGAGAAAGAGG - Intronic
905319905 1:37108451-37108473 CTCTAGCAACAGAAACATTGTGG + Intergenic
906310931 1:44753918-44753940 CTGGAGCCTCAGAAATGCTGGGG - Intronic
909610162 1:77543020-77543042 CTGCAGCAGCAGAATTGCTGAGG - Intronic
910591760 1:88933801-88933823 CTGTAGCAACAGAAATCCCATGG - Intergenic
912375413 1:109205596-109205618 CTGTAGCCTCAGCAATACTTGGG + Intronic
914090137 1:144489849-144489871 CAGGCGCATCAGAAATACTGAGG - Intergenic
918252932 1:182720002-182720024 CTGAAGAAGCAGAAATTATGTGG - Intergenic
918722816 1:187875592-187875614 CTGGAGCAGGAGAAATAGAGGGG + Intergenic
921822281 1:219630929-219630951 CTGTGGCAGCAGGCATACAGAGG + Intergenic
1063470692 10:6282508-6282530 CCGTAGCAGCAGATGTAGTGAGG + Intergenic
1068601737 10:58964041-58964063 CTGCAGCTGCAGAATTCCTGAGG - Intergenic
1074378545 10:112959505-112959527 TTGTTGCAGCAGAATTTCTGAGG + Intronic
1080344042 11:31301440-31301462 ATCTAGCAGCAGAAATATTAAGG + Intronic
1080799793 11:35599559-35599581 CTGCAGCTGCAGAAACTCTGAGG - Intergenic
1083696127 11:64443887-64443909 CTGTAGGAGCAGAAGTCCAGTGG + Intergenic
1083829483 11:65222332-65222354 CTGTAGCATCAGGAAGTCTGGGG - Intergenic
1085205723 11:74730987-74731009 CTCTAGCAGCAGACCTCCTGGGG - Exonic
1085298210 11:75442815-75442837 CTCTAGAAGGAGAAATGCTGTGG - Intronic
1087776812 11:102264186-102264208 CTGGAGGAGCTGAAATAATGGGG + Intergenic
1087948087 11:104189330-104189352 CAGCTGCAGCAGAAATACTTAGG + Intergenic
1099162876 12:79266813-79266835 CTGTAGCAGCACAAATCCATTGG + Intronic
1099999632 12:89817977-89817999 TTCTAGGAGCAGAAAGACTGTGG - Intergenic
1100599973 12:96104665-96104687 CTGTAGAATGAGAAGTACTGGGG + Intergenic
1101218069 12:102605274-102605296 CTGTAATGGCAGAAATGCTGTGG + Intergenic
1102305905 12:111804284-111804306 CTGTCCCATGAGAAATACTGAGG + Intronic
1104192095 12:126491729-126491751 ATATAGCAACAGAAATACTTAGG + Intergenic
1105268308 13:18843804-18843826 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1105554227 13:21430477-21430499 CTATCCCAGCAGGAATACTGGGG + Intronic
1107525239 13:41224280-41224302 CTGTAGCATGAGACAAACTGTGG - Intronic
1108836880 13:54561617-54561639 CTGTAGAAGTAGAGAAACTGTGG - Intergenic
1109386677 13:61638133-61638155 CTGTTGAAGCAGAAATAATTTGG + Intergenic
1109608420 13:64730574-64730596 CTGGAGTAGGAGAAATAGTGGGG - Intergenic
1110752179 13:79127539-79127561 CTGTAGCAGCAAAAATGTGGGGG + Intergenic
1112296003 13:98187733-98187755 CTATAGCTGCAGAAATCGTGTGG + Intronic
1112604396 13:100890013-100890035 CTATAGGAGCAGAAACTCTGGGG - Intergenic
1113093282 13:106637051-106637073 CTGAGGCAGAAGAATTACTGAGG - Intergenic
1114208195 14:20593194-20593216 TTGATGCAGAAGAAATACTGTGG - Intronic
1117115867 14:52510802-52510824 CTGGAGCATCAGAAATCCTATGG + Intronic
1119577169 14:75735352-75735374 CTGTGGGAGCAGAAGCACTGTGG + Intronic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120642539 14:87032615-87032637 TTGTAACAACAGAAAGACTGAGG - Intergenic
1202831004 14_GL000009v2_random:30190-30212 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1125199701 15:37092171-37092193 CTGTGACAGAATAAATACTGCGG - Intronic
1126131031 15:45341389-45341411 CTCCAGCAGCTGAGATACTGGGG + Intergenic
1126634538 15:50767902-50767924 CTGTGGCAGAAGAAATAGGGAGG + Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129050142 15:72774360-72774382 ATGTAGGAGCAGGCATACTGGGG + Intronic
1129475954 15:75784846-75784868 CTGTAGCAGCAGGAAGCTTGGGG + Intergenic
1130081187 15:80735102-80735124 CTGTGGCAGGAGAAAGAATGAGG + Intronic
1130773359 15:86947711-86947733 GTGTAGCAGCTGAATGACTGAGG + Intronic
1132062550 15:98704372-98704394 CTGAAGGAGCAGAAGCACTGTGG + Intronic
1135717979 16:24789533-24789555 TGGTAGCAGCAGCAATAATGTGG + Exonic
1136628568 16:31476514-31476536 CTGACGCAGCAGAAATGCTCTGG - Exonic
1137225518 16:46503320-46503342 CTATATCTGCAGAAATACTGTGG + Intergenic
1138689712 16:58755907-58755929 CTGGAGCAGGAGAAAGAATGGGG + Intergenic
1138937542 16:61747840-61747862 CTGCAACAGCAGAAATTCAGAGG - Intronic
1140953449 16:79840478-79840500 CTTTATCTGCAGACATACTGAGG + Intergenic
1143049566 17:4113336-4113358 CTTTAGAAGAAGAAATAGTGTGG - Intronic
1143520159 17:7440191-7440213 CTGGAGCTGCAGAAATCCTTGGG - Intronic
1143709777 17:8726235-8726257 CTGGGGCAGAAGAAATTCTGTGG - Intergenic
1143709949 17:8727247-8727269 CTGGGGCAGAAGAAATTCTGTGG + Intergenic
1145304693 17:21667040-21667062 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1150434221 17:65141470-65141492 ATGCAGAAGCAGAAATATTGAGG + Intronic
1151907279 17:77056703-77056725 CTGTTGCAGCAGCAATTCTCTGG + Intergenic
1154419711 18:14216230-14216252 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1154955271 18:21247883-21247905 CTGTTGAATCAGAAATTCTGGGG + Intronic
1156251655 18:35357967-35357989 GTGTAGCATCAGGAATAATGTGG + Intergenic
1158969113 18:62650073-62650095 CTGAAGCTGCAGAACTACTCAGG - Intergenic
1159144454 18:64436189-64436211 CTGTTGCAGCACTTATACTGTGG + Intergenic
1159736202 18:72100858-72100880 GTGGAGCAGCAGAAATCATGTGG + Intergenic
1164134021 19:22394824-22394846 TTACAGCAGCAGAAAGACTGTGG + Intronic
1164164786 19:22661942-22661964 TTACAGCAGCAGAAAGACTGTGG - Intronic
1164384369 19:27760640-27760662 CTCTATCATCAGAATTACTGGGG + Intergenic
1164385182 19:27765828-27765850 CTCTATCAGTAGAAATCCTGGGG + Intergenic
1164532618 19:29059813-29059835 CTGCAGCAGGAGAAACACTCGGG + Intergenic
1164556703 19:29258623-29258645 CTGAACCAGCAGAACCACTGGGG - Intergenic
1166759655 19:45216614-45216636 ATGTAGCAGAAGACATACTATGG + Intronic
1168635745 19:57995320-57995342 CTGGAGCAGCAAAAACAATGGGG + Intronic
1168719299 19:58546033-58546055 CTCCAGAAGCAGAAAAACTGGGG + Intronic
925618443 2:5766733-5766755 ATGTAGCAGCAGAAAGTCTCAGG - Intergenic
926318574 2:11731023-11731045 CTGCAGGAGCAAAAACACTGAGG - Intronic
926665676 2:15519769-15519791 CAGCAGCATCAGAAAAACTGGGG - Intronic
929005288 2:37387608-37387630 CTGCAGCAGCTGCAACACTGAGG + Intergenic
929749757 2:44697929-44697951 CTGGGGAAGCAGAAATACTGGGG + Intronic
929841331 2:45467087-45467109 CTGTAGGATCAGAAATTCAGGGG - Intronic
931441610 2:62294163-62294185 CTGCAGCTGCAGACATGCTGTGG + Intergenic
932174843 2:69590313-69590335 CCGTAGCAGCAGAAATGCTAAGG + Intronic
932816595 2:74866712-74866734 CTGAAGCAACAGAAAAGCTGTGG - Intronic
933032086 2:77341462-77341484 CAATAGCAGCTGAAATAATGTGG - Intronic
933108488 2:78364902-78364924 CTGTAGCACTAAAAATAATGTGG - Intergenic
934497517 2:94821034-94821056 CTGTAGCAGCAGAAATACTGTGG + Intergenic
935243363 2:101197003-101197025 CTTTCTCAGCAGAAACACTGTGG - Intronic
935709960 2:105889518-105889540 CTGCTGTAGCAGAAATTCTGGGG - Intronic
936923954 2:117717837-117717859 CTGTGGCAGCAGAAAATGTGAGG + Intergenic
936982242 2:118275708-118275730 CTGTAGGAGAAGAATTGCTGAGG - Intergenic
937575868 2:123421413-123421435 CTATAGCAACAGGAATACAGAGG + Intergenic
939290405 2:140187139-140187161 CTGGAGAAGGAGAAATAATGTGG - Intergenic
942230309 2:173854944-173854966 GTGTAGAAACAGAAATAATGAGG - Intergenic
1169305854 20:4489724-4489746 CTGTTGCAGAAGAAACAGTGTGG - Intergenic
1169397451 20:5245423-5245445 CTGTAGCACTAAAAATAATGTGG - Intergenic
1169934037 20:10864156-10864178 CTGGAACAGCTGATATACTGAGG + Intergenic
1170493028 20:16897893-16897915 CTGTAGCAGCAGCATCACTTTGG + Intergenic
1171522208 20:25784480-25784502 CTGGAGGAGCAGAAAGAATGAGG - Intronic
1171529957 20:25846425-25846447 CTGGAGGAGCAGAAAGAATGAGG - Intronic
1171554619 20:26071403-26071425 CTGGAGGAGCAGAAAGAATGAGG + Intergenic
1171888806 20:30687777-30687799 CTATAGCAGCAGAAATCCTGTGG + Intergenic
1175034576 20:55988041-55988063 TTATAGAAGCAGAAATTCTGGGG + Intergenic
1176610192 21:8875029-8875051 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1176656011 21:9589477-9589499 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1176853584 21:13943067-13943089 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1178174786 21:30083973-30083995 CTGAAGCAAGAGAAACACTGTGG + Intergenic
1178588898 21:33892871-33892893 GTAAAGCAGCAGAAAGACTGAGG + Exonic
1178916859 21:36709607-36709629 CTGGAGCAGCAGAAATGATTGGG + Intronic
1181569940 22:23763116-23763138 CTGAAGCAGCAGAACCACAGAGG + Exonic
1182546884 22:31081666-31081688 CTGTGGCGGCAGAAACCCTGGGG + Intronic
1183887722 22:40898868-40898890 CTGAAGCTACAGAAATGCTGTGG - Intronic
1184517277 22:44970464-44970486 CTGTAGCAGCAGACCTAGAGGGG - Intronic
949628238 3:5892224-5892246 CTGTGACTCCAGAAATACTGTGG - Intergenic
951814453 3:26738274-26738296 CTCTTGAAACAGAAATACTGGGG + Intergenic
952831124 3:37565874-37565896 CTGTTTCGCCAGAAATACTGGGG + Intronic
953072247 3:39532502-39532524 CTGTAGAAAAAGAAACACTGTGG + Intergenic
960147336 3:114217359-114217381 CTGTCCCTTCAGAAATACTGGGG - Intergenic
960845549 3:122001352-122001374 ATATAGCAGCAGCAATACTGAGG + Exonic
962176039 3:133156266-133156288 CTGCAGTAGCTGAGATACTGTGG + Intronic
964711571 3:159676952-159676974 CAGTAGAGGCAGAACTACTGTGG + Intronic
966601654 3:181781495-181781517 CTGCAACAGCAGAAACACTTTGG + Intergenic
967571989 3:191040420-191040442 CTGTAACAGCAGAAATGATTAGG - Intergenic
968351718 3:198061794-198061816 CTGTAACAGCAGAAATACTGTGG + Intergenic
1202736873 3_GL000221v1_random:9816-9838 CTGTAGCAGCAGAAATACTGTGG - Intergenic
974672499 4:65050471-65050493 CTGAAGCAGGAGAAGGACTGCGG - Intergenic
977392586 4:96430612-96430634 CTGTACCAGAAGAATTACTTTGG - Intergenic
978198596 4:105998517-105998539 CTGAAGCACTAGAAAGACTGGGG + Intronic
978237545 4:106477770-106477792 GTGTAGCAGCAAAAATCTTGAGG - Intergenic
978482657 4:109211897-109211919 CTATAGCAGGAGAAAGAATGTGG + Intronic
978675244 4:111306355-111306377 ATGCAGCAAAAGAAATACTGAGG - Intergenic
979167246 4:117550504-117550526 CTCTACCAGCGGGAATACTGAGG + Intergenic
980140268 4:128907283-128907305 CTGTAGCAGGAAAAATAGTAAGG + Intronic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
983762531 4:171429499-171429521 CTGTAGTTGGAGAAATACTGAGG + Intergenic
991982766 5:72250412-72250434 CTGGAGAAGCAGCATTACTGTGG - Intronic
992097256 5:73374279-73374301 CTGAAGCAGCAAAATTACTGTGG + Intergenic
992112102 5:73504787-73504809 CTGTAGCAGCATAACTCCTTTGG + Intronic
992158357 5:73976747-73976769 CTGGATCCTCAGAAATACTGTGG + Intergenic
995130795 5:108628331-108628353 CTGTGGAAGTGGAAATACTGAGG + Intergenic
995301150 5:110584944-110584966 CTTTAGCACCATAAATACTTTGG + Intronic
996524725 5:124466585-124466607 AAGGAGCAGCAGAAACACTGTGG + Intergenic
996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG + Intergenic
997151903 5:131505867-131505889 TTGTAGCAGTAGAGAAACTGAGG - Intronic
999675348 5:153995642-153995664 GTGTAGCAGCAAAATTACTGTGG - Intronic
1001436865 5:171705920-171705942 CCTTAGCAGCACAAATACAGAGG + Intergenic
1001594396 5:172888565-172888587 CTGAAAGAGCAGAAAAACTGTGG + Intronic
1001901440 5:175433818-175433840 CTGTTTCAGCAGAATTAGTGTGG + Intergenic
1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG + Intergenic
1004496764 6:16171610-16171632 CTGTAGCAGCAGTAAAATAGAGG + Intergenic
1005005795 6:21286370-21286392 ATGGTGCAGCAGTAATACTGGGG - Intergenic
1005105636 6:22221569-22221591 TAGAAGAAGCAGAAATACTGTGG - Intergenic
1005206131 6:23407133-23407155 CTGTAATAGCAGAAATTCTTTGG - Intergenic
1007046561 6:38781303-38781325 CTATAGCAGGAAAAATACTCTGG + Exonic
1008256809 6:49311969-49311991 CCGTAACAGCACAAATTCTGGGG - Intergenic
1011238427 6:85243633-85243655 CTAGAGCAGCAGATATCCTGGGG - Intergenic
1012613069 6:101240116-101240138 CAGTTGCAGCAGGATTACTGGGG - Intergenic
1013838080 6:114356629-114356651 CTGTGGAAGCAGAAAGAATGAGG + Intergenic
1015289172 6:131519326-131519348 CTGTTGCAGGAGAATTATTGTGG + Intergenic
1017327082 6:153151983-153152005 CTGCAGCAGCAGCAGTACTCTGG - Intergenic
1020031831 7:4938712-4938734 CTGTAGCAGAGGAGAGACTGGGG + Intronic
1022300252 7:29096179-29096201 CTGTAGCCAGAGAACTACTGGGG + Exonic
1023016225 7:35971068-35971090 TCGTAGCAACAGCAATACTGGGG - Intergenic
1023032786 7:36105370-36105392 CTGGAGCAACAGAAATAATCTGG + Intergenic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1025264909 7:57448888-57448910 CTGAGGCAGCAGAAAACCTGAGG - Intergenic
1025282698 7:57639655-57639677 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1025302019 7:57825762-57825784 CTGGAGGAGCAGAAAGAATGAGG + Intergenic
1026223317 7:68419159-68419181 CTGAAGGTACAGAAATACTGGGG - Intergenic
1026894181 7:74000510-74000532 CTCTGGCAGCAGAGAGACTGGGG + Intergenic
1027974229 7:85128799-85128821 CTGTATCAGCATAAATAATTGGG + Intronic
1028932896 7:96433305-96433327 ATATAGAAGCAGAAATCCTGTGG + Intergenic
1029563314 7:101318536-101318558 CAGTAGCAGCACCAATAATGAGG + Intronic
1031269743 7:119633523-119633545 CTGTAGCCACAAAAATATTGTGG + Intergenic
1031529215 7:122855925-122855947 CTGTAGCTGTAGGAAGACTGGGG - Intronic
1034593065 7:152160339-152160361 CTGCAGAATCAGAAATACCGGGG + Intronic
1035103024 7:156416859-156416881 CTGTGGCTGCAGCAAAACTGTGG - Intergenic
1038213954 8:25544547-25544569 CAATAGCAACAAAAATACTGAGG - Intergenic
1038361697 8:26885921-26885943 CTGAAGCAGGAGAAATTCAGAGG + Intergenic
1039341413 8:36654231-36654253 CTGTGTCAGCAGAAATTCTAAGG - Intergenic
1040077574 8:43253760-43253782 CTGCAACAGCGGAAATACTGTGG - Intergenic
1042199191 8:66263795-66263817 CTGATGCCACAGAAATACTGAGG + Intergenic
1042551099 8:69994764-69994786 CTGTAGCAGCTGAAGGGCTGCGG - Intergenic
1046187288 8:110738218-110738240 CTGGAGGAGCAGATATACAGAGG - Intergenic
1047021348 8:120777930-120777952 CAGCAGCAGCAGAAACACTTTGG + Intronic
1047364628 8:124200799-124200821 CTCTTGAATCAGAAATACTGGGG + Intergenic
1047381245 8:124365895-124365917 CTGTAACACCACAAATACAGTGG - Intronic
1047569618 8:126083751-126083773 ATGCAGGTGCAGAAATACTGAGG - Intergenic
1048614625 8:136059641-136059663 CTGTGGCAGCAGCAATACAGAGG - Intergenic
1049060643 8:140273624-140273646 CTGGAGCAGCAGGAATGCCGAGG - Intronic
1049466809 8:142755105-142755127 GTTTAGCAGCAGCATTACTGTGG - Intergenic
1053659628 9:40259437-40259459 CTGTAGCAGCAGAAATACTGTGG - Intronic
1053909999 9:42888789-42888811 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054360640 9:64112188-64112210 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054371756 9:64405736-64405758 CTGTAGCAGCAGAAATACTGTGG - Intronic
1054524970 9:66116779-66116801 CTGTAGCAGCAGAAATACTGTGG + Intronic
1054679375 9:67895453-67895475 CTGTAGCAGCAGAAATACTGTGG - Intronic
1055203584 9:73698074-73698096 TAGTAGCAGAAGAAATAGTGAGG - Intergenic
1056021462 9:82442166-82442188 CTCTAACAGCAGAAATTATGGGG - Intergenic
1056826376 9:89879023-89879045 CTGGAGCTGCAGAAACTCTGGGG + Intergenic
1058613350 9:106799173-106799195 CTGTAGCTGCAGTGAAACTGAGG - Intergenic
1059238439 9:112782449-112782471 TTGTTGCAGGAGAGATACTGTGG + Intronic
1059780135 9:117517581-117517603 ATGTAGCAACAGAAATGCTCTGG + Intergenic
1060360136 9:122948158-122948180 CTGTAGCAGGATAATTCCTGTGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1203705598 Un_KI270742v1:40260-40282 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1203633728 Un_KI270750v1:92937-92959 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1189744973 X:44159658-44159680 CTTTATCAGCAGAAATGATGAGG + Intronic
1192328086 X:70150404-70150426 CTTTAGGAACAGAAATAGTGGGG + Intronic
1193534304 X:82693997-82694019 CTGTAACAGCAGAAATTATTAGG - Intergenic
1195347092 X:103962073-103962095 CTGTAGGAGCAGAAGTCCTCAGG - Intronic
1195360350 X:104076768-104076790 CTGTAGGAGCAGAAGTCCTCAGG + Intergenic
1196032417 X:111104879-111104901 CTGTAACAGAAGACATGCTGTGG + Intronic
1198737284 X:139800594-139800616 CAGCAGCAGCAGCATTACTGGGG - Intronic
1199727841 X:150602550-150602572 ATGTAGCAGGAGCCATACTGTGG - Intronic