ID: 1053915767

View in Genome Browser
Species Human (GRCh38)
Location 9:42944563-42944585
Sequence AAAGATGCACAGTTACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053915759_1053915767 19 Left 1053915759 9:42944521-42944543 CCTGCATCCCTGCAGCTCCAGCT 0: 25
1: 47
2: 177
3: 665
4: 1726
Right 1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG No data
1053915760_1053915767 12 Left 1053915760 9:42944528-42944550 CCCTGCAGCTCCAGCTCCAGCTC 0: 19
1: 19
2: 47
3: 227
4: 1074
Right 1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG No data
1053915765_1053915767 -10 Left 1053915765 9:42944550-42944572 CCAGCCATGGCTGAAAGATGCAC 0: 42
1: 49
2: 25
3: 80
4: 677
Right 1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG No data
1053915764_1053915767 -4 Left 1053915764 9:42944544-42944566 CCAGCTCCAGCCATGGCTGAAAG 0: 36
1: 190
2: 340
3: 482
4: 696
Right 1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG No data
1053915763_1053915767 2 Left 1053915763 9:42944538-42944560 CCAGCTCCAGCTCCAGCCATGGC 0: 17
1: 24
2: 39
3: 119
4: 892
Right 1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG No data
1053915758_1053915767 22 Left 1053915758 9:42944518-42944540 CCGCCTGCATCCCTGCAGCTCCA 0: 4
1: 0
2: 8
3: 66
4: 714
Right 1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG No data
1053915761_1053915767 11 Left 1053915761 9:42944529-42944551 CCTGCAGCTCCAGCTCCAGCTCC 0: 22
1: 26
2: 68
3: 356
4: 1762
Right 1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053915767 Original CRISPR AAAGATGCACAGTTACAGCT TGG Intergenic
No off target data available for this crispr