ID: 1053918344

View in Genome Browser
Species Human (GRCh38)
Location 9:42962678-42962700
Sequence ACAGCTTGTGGGCTGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053918344_1053918350 -6 Left 1053918344 9:42962678-42962700 CCTGCATTCAGCCCACAAGCTGT No data
Right 1053918350 9:42962695-42962717 AGCTGTGGGTTGGACAAGCTTGG 0: 4
1: 29
2: 69
3: 134
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053918344 Original CRISPR ACAGCTTGTGGGCTGAATGC AGG (reversed) Intergenic
No off target data available for this crispr